Product Code Database
Transfer ribonucleic acid ( tRNA), formerly referred to as soluble ribonucleic acid ( sRNA), is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the genetic code in messenger RNA (mRNA) and the amino acid sequence of proteins, carrying the correct sequence of amino acids to be combined by the protein-synthesizing machinery, the ribosome. Each three-nucleotide codon in mRNA is Base pair by a three-nucleotide anticodon in tRNA. As such, tRNAs are a necessary component of translation, the biological synthesis of new in accordance with the genetic code.
On the other end of the tRNA is a covalent attachment to the amino acid corresponding to the anticodon sequence, with each type of tRNA attaching to a specific amino acid. Because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which carry the same amino acid.
The covalent attachment to the tRNA 3' end is catalysed by enzymes called aminoacyl tRNA synthetases. During protein synthesis, tRNAs with attached amino acids are delivered to the ribosome by proteins called elongation factors, which aid in association of the tRNA with the ribosome, synthesis of the new polypeptide, and translocation (movement) of the ribosome along the mRNA. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3' end to the amino acid attached to the 3' end of the newly delivered tRNA, a reaction catalyzed by the ribosome. A large number of the individual nucleotides in a tRNA molecule may be chemically modified, often by methylation or deamidation. These unusual bases sometimes affect the tRNA's interaction with and sometimes occur in the anticodon to alter base-pairing properties.
The addition of a guanine nucleotide at the -1 position (G-1) to the 5′ end of tRNA-His, catalyzed by tRNA-His guanylyltransferase (Thg1) and Thg1-like proteins (TLPs) is particularly notable as it proceeds in the 3′ to 5′ direction, which is opposite to the canonical 5′ to 3′ nucleotide addition used by all other known nucleic acid polymerases. This reverse polymerization mechanism is biochemically unique and evolutionarily conserved, highlighting its fundamental importance in tRNA maturation. Homologs of Thg1 are found in all domains of life, where they can also participate in tRNA repair and quality control. The presence of G-1 is a key identity element for tRNA-His, and its absence severely impairs histidylation efficiency and tRNA function.
Once translation initiation is complete, the first aminoacyl tRNA is located in the P/P site, ready for the elongation cycle described below. During translation elongation, tRNA first binds to the ribosome as part of a complex with elongation factor Tu (EF-Tu) or its eukaryotic (eEF-1) or archaeal counterpart. This initial tRNA binding site is called the A/T site. In the A/T site, the A-site half resides in the small ribosomal subunit where the mRNA decoding site is located. The mRNA decoding site is where the mRNA codon is read out during translation. The T-site half resides mainly on the large ribosomal subunit where EF-Tu or eEF-1 interacts with the ribosome. Once mRNA decoding is complete, the aminoacyl-tRNA is bound in the A/A site and is ready for the next peptide bond to be formed to its attached amino acid. The peptidyl-tRNA, which transfers the growing polypeptide to the aminoacyl-tRNA bound in the A/A site, is bound in the P/P site. Once the peptide bond is formed, the tRNA in the P/P site is acylated, or has a free 3' end, and the tRNA in the A/A site dissociates the growing polypeptide chain. To allow for the next elongation cycle, the tRNAs then move through hybrid A/P and P/E binding sites, before completing the cycle and residing in the P/P and E/E sites. Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one codon and the A/T site is vacant, ready for the next round of mRNA decoding. The tRNA bound in the E/E site then leaves the ribosome.
The P/I site is actually the first to bind to aminoacyl tRNA, which is delivered by an initiation factor called IF2 in bacteria. However, the existence of the P/I site in eukaryotic or archaeal has not yet been confirmed. The P-site protein L27 has been determined by affinity labeling by E. Collatz and A. P. Czernilofsky ( FEBS Lett., Vol. 63, pp. 283–286, 1976).
In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes Ensembl release 70 - Jan 2013 http://www.ensembl.org/Homo_sapiens/Info/StatsTable?db=core in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived pseudogenes—tRNA genes thought to be no longer functional (although pseudo tRNAs have been shown to be involved in antibiotic resistance in bacteria). As with all eukaryotes, there are 22 tRNA genesHartwell LH, Hood L, Goldberg ML, Reynolds AE, Silver LM, Veres RC. (2004). Genetics: From Genes to Genomes 2nd ed. McGraw-Hill: New York. p. 529. in humans. Mutations in some of these genes have been associated with severe diseases like the MELAS syndrome. Regions in nuclear chromosomes, very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes). These tRNA-lookalikes are also considered part of the Numt (genes transferred from the mitochondria to the nucleus). The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to the opossum suggesting the possibility that the lookalikes are functional.
In humans, cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well as on chromosome 1.
The HGNC, in collaboration with the Genomic tRNA Database ( GtRNAdb) and experts in the field, has approved unique names for human genes that encode tRNAs.
Typically, tRNAs genes from Bacteria are shorter (mean = 77.6 bp) than tRNAs from Archaea (mean = 83.1 bp) and eukaryotes (mean = 84.7 bp). The mature tRNA follows an opposite pattern with tRNAs from Bacteria being usually longer (median = 77.6 nt) than tRNAs from Archaea (median = 76.8 nt), with eukaryotes exhibiting the shortest mature tRNAs (median = 74.5 nt).
Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA. As an example, tRNAAla encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in codon usage bias. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency.
Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs. For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called wobbling, in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases the propensity for translation errors. The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection. Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias is what necessitates codon optimization.
Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth. Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation.
Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA “elbow” (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
tRFs have multiple dependencies and roles; such as exhibiting significant changes between sexes, among races and disease status. Functionally, they can be loaded on Ago and act through RNAi pathways, participate in the formation of stress granules, displace mRNAs from RNA-binding proteins or inhibit translation. At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection, cancer, cell proliferation and also with epigenetic transgenerational regulation of metabolism.
tRFs are not restricted to humans and have been shown to exist in multiple organisms.
Two online tools are available for those wishing to learn more about tRFs: the framework for the interactive exploration of mitochondrial and nuclear tRNA fragments ( MINTbase) and the relational database of Transfer RNA related Fragments ( tRFdb). MINTbase also provides a naming scheme for the naming of tRFs called tRF-license plates (or MINTcodes) that is genome independent; the scheme compresses an RNA sequence into a shorter string.
In 1990, tRNA (modified from the tRNA gene metY) was inserted into E. coli, causing it to initiate protein synthesis at the UAG stop codon, as long as it is preceded by a strong Shine-Dalgarno sequence. At initiation it not only inserts the traditional formylmethionine, but also formylglutamine, as glutamyl-tRNA synthase also recognizes the new tRNA. The experiment was repeated in 1993, now with an elongator tRNA modified to be recognized by the methionyl-tRNA formyltransferase. A similar result was obtained in Mycobacterium. Later experiments showed that the new tRNA was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in a genomically recoded E. coli strain.
Pre-tRNAs undergo extensive modifications inside the nucleus. Some pre-tRNAs contain that are spliced, or cut, to form the functional tRNA molecule; in bacteria these self-splice, whereas in eukaryotes and archaea they are removed by tRNA-splicing . Eukaryotic pre-tRNA contains bulge-helix-bulge (BHB) structure motif that is important for recognition and precise splicing of tRNA intron by endonucleases. This motif position and structure are evolutionarily conserved. However, some organisms, such as unicellular algae have a non-canonical position of BHB-motif as well as 5′- and 3′-ends of the spliced intron sequence. The 5′ sequence is removed by RNase P, whereas the 3′ end is removed by the Ribonuclease Z enzyme. A notable exception is in the archaeon Nanoarchaeum equitans, which does not possess an RNase P enzyme and has a promoter placed such that transcription starts at the 5′ end of the mature tRNA. The non-templated 3′ CCA tail is added by a nucleotidyl transferase. Before tRNAs are Nuclear export into the cytoplasm by Los1/Xpo-t, tRNAs are aminoacylation. The order of the processing events is not conserved. For example, in yeast, the splicing is not carried out in the nucleus but at the cytoplasmic side of membranes.
|
|
